The structure of a plant-specific partitivirus capsid reveals a unique coat protein domain architecture with an intrinsically disordered protrusion

The structure of a plant-specific partitivirus capsid reveals a unique coat protein domain architecture with an intrinsically disordered protrusion

Persistent plant viruses could also be the commonest viruses in wild vegetation. A rising physique of proof for mutualism between such viruses and their hosts, means that they play an vital position in ecology and agriculture. Right here we current the capsid construction of a plant-specific partitivirus, Pepper cryptic virus 1, at 2.9 Å decision by Cryo-EM.
Structural options, together with the T = 1 association of 60 coat protein dimers, are shared with fungal partitiviruses and the picobirnavirus lineage of dsRNA viruses. Nonetheless, the topology of the capsid is markedly completely different with protrusions emanating from, and partly comprising, the binding interface of coat protein dimers.
We present {that a} disordered area on the apex of the protrusion just isn’t required for capsid meeting and represents a hypervariable website distinctive to, and attribute of, the plant-specific partitiviruses. These outcomes counsel a structural foundation for the acquisition of further features by partitivirus coat proteins that permits mutualistic relationships with numerous plant hosts.

Sulforaphane covalently interacts with the transglutaminase 2 most cancers upkeep protein to change its construction and suppress its exercise

Sort 2 transglutaminase (TG2) features as an vital most cancers cell survival protein in a variety of cancers together with epidermal squamous cell carcinoma. TG2 exists in open and closed conformations every of which has a definite and mutually unique exercise.
The closed conformation has GTP-binding/GTPase exercise whereas the open conformation features as a transamidase to catalyze protein-protein crosslinking. GTP-binding/GTPase exercise is required for TG2 upkeep of the aggressive most cancers phenotype.
Thus, figuring out brokers that convert TG2 from the closed to the open GTP-binding/GTPase inactive conformation is a vital most cancers prevention/remedy technique. Sulforaphane (SFN) is a vital diet-derived most cancers prevention agent that’s identified to own a reactive isothiocyanate group and has potent anticancer exercise.
Utilizing a biotin-tagged SFN analog (Biotin-ITC) and kinetic evaluation we present that SFN covalently and irreversibly binds to recombinant TG2 to inhibit transamidase exercise and shift TG2 to an open/prolonged conformation, resulting in a partial inhibition of GTP binding.
We additionally present that incubation of most cancers cells or most cancers cell extract with Biotin-ITC leads to formation of a TG2/Biotin-ITC advanced and that SFN remedy of most cancers cells inhibits TG2 transamidase exercise and shifts TG2 to an open/prolonged conformation. These findings determine TG2 as a direct SFN anticancer goal in epidermal squamous cell carcinoma.

Impact of Warmth Remedy on the Property, Construction, and Aggregation of Skim Milk Proteins

To review the mechanism of heat-induced protein aggregates, skim milk was heated at 55, 65, 75, 85, and 95°C for 30 s. Then, the sulfhydryl content material, floor hydrophobicity, and secondary construction of heat-treated skim milk have been studied. Treating skim milk at completely different temperatures induced a lower in sulfhydryl content material (75.9% at 95°C) and a rise in floor hydrophobicity (44% at 95°C) with a disrupted secondary construction containing random coil, β-sheet, and β-turn of skim milk proteins.
The change in these properties facilitated mixture formation via disulfide bonds and hydrophobicity interplay. Microstructural statement additionally confirmed the next diploma of aggregation when skim milk was heated at 85 and 95°C. The results of two-dimensional polyacrylamide gel electrophoresis demonstrated that the aggregates consisted of a excessive proportion of κ-casein, β-lactoglobulin, and different whey proteins.

Impact of ultrasonic remedy on the construction and purposeful properties of mantle proteins from scallops (Patinopecten yessoensis)

On this examine, scallop mantle protein was handled by ultrasound at completely different powers, after which analyzed by ANS fluorescent probes, round dichroism spectroscopy, endogenous fluorescence spectrum, DNTB colorimetry and in-vitro digestion mannequin to elucidate the structure-function relationship.
The outcomes indicated that ultrasound can considerably have an effect on the secondary construction of scallop mantle protein like enhancing hydrophobicity, decreasing the particle measurement, growing the relative contents of α-helix and lowering contents of β-pleated sheet, β-turn and random coil, in addition to altering intrinsic fluorescence depth with blue shift of most fluorescence peak.
However ultrasound had no impact on its main construction. Furthermore, the features of scallop mantle protein have been regulated by modifying its buildings by ultrasound. Particularly, the protein had the best efficiency in foaming property and in-vitro digestibility beneath ultrasonic energy of 100 W, oil binding capability beneath 100 W, water binding capability beneath 300 W, solubility and emulsification capability beneath 400 W, and emulsion stability beneath 600 W.
These outcomes show ultrasonic remedy has the potential to successfully enhance purposeful properties and high quality of scallop mantle protein, benefiting in complete utilization of scallop mantles.

An Integrative Method to Decide 3D Protein Constructions Utilizing Sparse Paramagnetic NMR Information and Bodily Modeling

Paramagnetic nuclear magnetic resonance (NMR) strategies have emerged as highly effective instruments for construction dedication of huge, sparsely protonated proteins. Nonetheless conventional functions face a number of challenges, together with a necessity for big datasets to offset the sparsity of restraints, the issue in accounting for the conformational heterogeneity of the spin-label, and noisy experimental knowledge.
Right here we suggest an integrative method to construction dedication combining sparse paramagnetic NMR with bodily modelling to deduce approximate protein structural ensembles. We use calmodulin in advanced with the sleek muscle myosin mild chain kinase peptide as a mannequin system.
Regardless of buying knowledge from samples labeled solely on the spine amide positions, we’re capable of produce an ensemble with a median RMSD of ∼2.eight Å from a reference X-ray crystal construction. Our method requires solely spine chemical shifts and measurements of the paramagnetic rest enhancement and residual dipolar couplings that may be obtained from sparsely labeled samples.
The structure of a plant-specific partitivirus capsid reveals a unique coat protein domain architecture with an intrinsically disordered protrusion

LZerD ProteinProtein Docking Webserver Enhanced With de novo Construction Prediction

Protein-protein docking is a useful gizmo for modeling the buildings of protein complexes which have but to be experimentally decided. Understanding the buildings of protein complexes is a key element for formulating hypotheses in biophysics relating to the purposeful mechanisms of complexes.
Protein-protein docking is a longtime method for circumstances the place the buildings of the subunits have been decided. Whereas the variety of identified buildings deposited within the Protein Information Financial institution is growing, there are nonetheless many circumstances the place the buildings of particular person proteins that customers need to dock will not be decided but.

Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His)

CU63-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

MARCO Recombinant Protein (Human)

RP018841 100 ug Ask for price

MARCO Recombinant Protein (Rat)

RP210899 100 ug Ask for price

Mouse Macrophage receptor MARCO, Marco ELISA KIT

ELI-16328m 96 Tests
EUR 865

Mouse Macrophage Receptor MARCO (MARCO) ELISA Kit

abx389793-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Macrophage Receptor MARCO (MARCO) Antibody

20-abx135966
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Macrophage Receptor MARCO (MARCO) Antibody

20-abx322023
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse MARCO shRNA Plasmid

20-abx971431
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Marco ELISA Kit| Mouse Macrophage receptor MARCO ELISA Kit

EF015428 96 Tests
EUR 689

MARCO Antibody

1-CSB-PA880072ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MARCO. Recognizes MARCO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MARCO antibody

70R-8509 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MARCO antibody

MARCO antibody

70R-6455 50 ug
EUR 467
Description: Rabbit polyclonal MARCO antibody raised against the N terminal of MARCO

MARCO siRNA

20-abx923573
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MARCO siRNA

20-abx923574
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Macrophage Receptor MARCO (MARCO) ELISA Kit

20-abx385113
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Macrophage receptor MARCO, MARCO ELISA KIT

ELI-39124h 96 Tests
EUR 824

Marco ORF Vector (Mouse) (pORF)

ORF049829 1.0 ug DNA
EUR 506

MARCO Protein Vector (Mouse) (pPB-C-His)

PV199314 500 ng
EUR 603

MARCO Protein Vector (Mouse) (pPB-N-His)

PV199315 500 ng
EUR 603

MARCO Protein Vector (Mouse) (pPM-C-HA)

PV199316 500 ng
EUR 603

MARCO Protein Vector (Mouse) (pPM-C-His)

PV199317 500 ng
EUR 603

MARCO Polyclonal Antibody

27273-100ul 100ul
EUR 252

MARCO Polyclonal Antibody

27273-50ul 50ul
EUR 187

MARCO Rabbit pAb

A10048-100ul 100 ul
EUR 308

MARCO Rabbit pAb

A10048-200ul 200 ul
EUR 459

MARCO Rabbit pAb

A10048-20ul 20 ul
EUR 183

MARCO Rabbit pAb

A10048-50ul 50 ul
EUR 223

MARCO Blocking Peptide

33R-3464 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCO antibody, catalog no. 70R-8509

MARCO Blocking Peptide

33R-7477 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCO antibody, catalog no. 70R-6455

MARCO cloning plasmid

CSB-CL880072HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1563
  • Sequence: atgagaaataagaaaattctcaaggaggacgagctcttgagtgagacccaacaagctgcttttcaccaaattgcaatggagcctttcgaaatcaatgttccaaagcccaagaggagaaatggggtgaacttctccctagctgtggtggtcatctacctgatcctgctcaccgctg
  • Show more
Description: A cloning plasmid for the MARCO gene.

MARCO Polyclonal Antibody

ABP59218-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of MARCO from Human, Mouse. This MARCO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460

MARCO Polyclonal Antibody

ABP59218-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of MARCO from Human, Mouse. This MARCO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460

MARCO Polyclonal Antibody

ABP59218-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of MARCO from Human, Mouse. This MARCO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460

MARCO Polyclonal Antibody

ES9781-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MARCO from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MARCO Polyclonal Antibody

ES9781-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MARCO from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MARCO antibody

STJ112088 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. The protein may bind both Gram-negative and Gram-positive bacteria via an extracellular, C-terminal, scavenger receptor cysteine-rich (SRCR) domain. In addition to short cytoplasmic and transmembrane domains, there is an extracellular spacer domain and a long, extracellular collagenous domain. The protein may form a trimeric molecule by the association of the collagenous domains of three identical polypeptide chains.

Anti-MARCO antibody

STJ190939 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MARCO

Mouse Anti Hamster Marco Monoclonal Antibody

DMABT-47716MH 0.25 mg
EUR 741

Marco sgRNA CRISPR Lentivector set (Mouse)

K3658301 3 x 1.0 ug
EUR 339

Mouse Macrophage Receptor With Collagenous Structure (MARCO) Protein

20-abx650074
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Recombinant Macrophage Receptor With Collagenous Structure (MARCO)

4-RPC614Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q60754
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Macrophage Receptor With Collagenous Structure expressed in: E.coli

Recombinant Macrophage Receptor With Collagenous Structure (MARCO)

4-RPC614Ra01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: M0R9F7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Macrophage Receptor With Collagenous Structure expressed in: E.coli

MARCO ELISA KIT|Human

EF005227 96 Tests
EUR 689

MARCO Polyclonal Conjugated Antibody

C27273 100ul
EUR 397

Human MARCO shRNA Plasmid

20-abx955715
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Marco sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3658302 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3658303 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3658304 1.0 ug DNA
EUR 154

MARCO Protein Vector (Human) (pPB-C-His)

PV025121 500 ng
EUR 329

MARCO Protein Vector (Human) (pPB-N-His)

PV025122 500 ng
EUR 329

MARCO Protein Vector (Human) (pPM-C-HA)

PV025123 500 ng
EUR 329

MARCO Protein Vector (Human) (pPM-C-His)

PV025124 500 ng
EUR 329

MARCO Protein Vector (Rat) (pPB-C-His)

PV281202 500 ng
EUR 603

MARCO Protein Vector (Rat) (pPB-N-His)

PV281203 500 ng
EUR 603

MARCO Protein Vector (Rat) (pPM-C-HA)

PV281204 500 ng
EUR 603

MARCO Protein Vector (Rat) (pPM-C-His)

PV281205 500 ng
EUR 603

Marco ORF Vector (Rat) (pORF)

ORF070301 1.0 ug DNA
EUR 506

MARCO ORF Vector (Human) (pORF)

ORF006281 1.0 ug DNA
EUR 95

Rat Macrophage Receptor With Collagenous Structure (MARCO) Protein

20-abx650075
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Marco sgRNA CRISPR Lentivector set (Rat)

K6667901 3 x 1.0 ug
EUR 339

MARCO sgRNA CRISPR Lentivector set (Human)

K1270701 3 x 1.0 ug
EUR 339

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse)

4-PAC614Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO)

Marco sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3658305 3 x 1.0 ug
EUR 376

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), APC

4-PAC614Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), Biotinylated

4-PAC614Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Biotin.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), Cy3

4-PAC614Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Cy3.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), FITC

4-PAC614Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with FITC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), HRP

4-PAC614Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with HRP.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), PE

4-PAC614Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with PE.

Macrophage Receptor With Collagenous Structure (MARCO) Antibody

20-abx131562
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Macrophage Receptor With Collagenous Structure (MARCO) Antibody

20-abx131563
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Marco sgRNA CRISPR Lentivector (Rat) (Target 1)

K6667902 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Rat) (Target 2)

K6667903 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Rat) (Target 3)

K6667904 1.0 ug DNA
EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 1)

K1270702 1.0 ug DNA
EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 2)

K1270703 1.0 ug DNA
EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 3)

K1270704 1.0 ug DNA
EUR 154

Marco 3'UTR Luciferase Stable Cell Line

TU112920 1.0 ml Ask for price

Marco 3'UTR GFP Stable Cell Line

TU162920 1.0 ml Ask for price

Marco 3'UTR Luciferase Stable Cell Line

TU212886 1.0 ml Ask for price

Marco 3'UTR GFP Stable Cell Line

TU262886 1.0 ml Ask for price

MARCO 3'UTR GFP Stable Cell Line

TU063026 1.0 ml
EUR 1394

MARCO 3'UTR Luciferase Stable Cell Line

TU013026 1.0 ml
EUR 1394

Marco sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3658306 1.0 ug DNA
EUR 167

Marco sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3658307 1.0 ug DNA
EUR 167

Marco sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3658308 1.0 ug DNA
EUR 167

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC614Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC-Cy7.

MARCO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV622369 1.0 ug DNA
EUR 682

MARCO Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV622373 1.0 ug DNA
EUR 682

MARCO Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV622374 1.0 ug DNA
EUR 682

Marco sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6667905 3 x 1.0 ug
EUR 376

MARCO sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1270705 3 x 1.0 ug
EUR 376

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat)

4-PAC614Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly367~Arg519)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO)

MARCO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV622370 1.0 ug DNA
EUR 682

MARCO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV622371 1.0 ug DNA
EUR 740

MARCO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV622372 1.0 ug DNA
EUR 740
Right here, we now have built-in the AttentiveDist methodology for protein construction prediction into our LZerD webserver for protein-protein docking, which allows customers to easily submit protein sequences and procure full-complex atomic fashions, with out having to provide any construction themselves. We’ve got additional prolonged the LZerD docking interface with a symmetrical homodimer mode. The LZerD server is on the market.

Leave a Reply

Your email address will not be published. Required fields are marked *