Crystal structure of a MarR family protein from the psychrophilic bacterium Paenisporosarcina sp. TG-14 in complex with a lipid-like molecule

Crystal structure of a MarR family protein from the psychrophilic bacterium Paenisporosarcina sp. TG-14 in complex with a lipid-like molecule

MarR household proteins regulate the transcription of a number of antibiotic-resistance genes and are broadly present in micro organism and archaea. Lately, a brand new MarR household gene was recognized by genome evaluation of the psychrophilic bacterium Paenisporosarcina sp.
TG-14, which was remoted from sediment-laden basal ice in Antarctica. On this research, the crystal construction of the MarR protein from Paenisporosarcina sp. TG-14 (PaMarR) was decided at 1.6 Å decision. Within the crystal construction, a novel lipid-type compound (palmitic acid) was present in a deep cavity, which was assumed to be an effector-binding web site.
Comparative structural evaluation of homologous MarR household proteins from a mesophile and a hyperthermophile confirmed that the DNA-binding area of PaMarR exhibited comparatively excessive mobility, with a disordered area between the β1 and β2 strands.
As well as, structural comparability with different homologous advanced constructions means that this construction constitutes a conformer reworked by palmitic acid. Biochemical evaluation additionally demonstrated that PaMarR binds to cognate DNA, the place PaMarR is understood to acknowledge two putative binding websites relying on its molar focus, indicating that PaMarR binds to its cognate DNA in a stoichiometric method.
The current research offers structural data on the cold-adaptive MarR protein with an aliphatic compound as its putative effector, extending the scope of MarR household protein analysis.

AlphaFold 2: Why It Works and Its Implications for Understanding the Relationships of Protein Sequence, Construction, and Operate

AlphaFold 2 (AF2) was the star of CASP14, the final biannual construction prediction experiment. Utilizing novel deep studying, AF2 predicted the constructions of many troublesome protein targets at or close to experimental decision. Right here, we current our perspective of why AF2 works and present that it’s a very refined fold recognition algorithm that exploits the completeness of the library of single area PDB constructions.
It has additionally realized native aspect chain packing rearrangements that allow it to refine proteins to excessive decision. The advantages and limitations of its potential to foretell the constructions of many extra proteins at or near atomic element are mentioned.

Forces concerned in freeze-induced egg yolk gelation: Results of assorted bond dissociation reagents on gel properties and protein construction adjustments

Urea, sodium dodecyl sulfate (SDS) and β-mercaptoethanol (2-ME) had been used to observe the roles of hydrogen bonds, hydrophobic interactions and disulfide bonds in frozen egg yolk. Yolk samples had been ready with a denaturant, and the textural traits, turbidity properties, protein patterns and constructions had been analysed.
The outcomes confirmed that SDS or 2-ME addition to egg yolk promoted its turbidity and texture properties, however urea modified the turbidity in another way. SDS-PAGE outcomes confirmed that yolk protein patterns with urea barely diminished the quantity of excessive molecular weight substances, whereas SDS and 2-ME addition elevated the quantity.
ATR-FTIR spectroscopy revealed that the protein secondary constructions modified from ordered constructions to random coils. The feel properties had been correlated with the protein secondary construction, particularly β-sheets and β-turns. Thus, the three bond dissociation reagents induced protein denaturation. Hydrogen bonds had been the vital power affecting frozen egg yolk gelation, adopted by hydrophobic interactions and disulfide bonds.

The First Cytoplasmic Loop within the Core Construction of the ABCC1 (Multidrug Resistance Protein 1; MRP1) Transporter Accommodates A number of Amino Acids Important for Its Expression

ABCC1 (human multidrug resistance protein 1 (hMRP1)) is an ATP-binding cassette transporter which effluxes xeno- and endobiotic natural anions and confers multidrug resistance by means of energetic drug efflux. The 17 transmembrane α-helices of hMRP1 are distributed amongst three membrane spanning domains (MSD0, 1, 2) with MSD1,2 every adopted by a nucleotide binding area to type the 4-domain core construction.
Eight conserved residues within the first cytoplasmic loop (CL4) of MSD1 within the descending α-helix (Gly392, Tyr404, Arg405), the perpendicular coupling helix (Asn412, Arg415, Lys416), and the ascending α-helix (Glu422, Phe434) had been focused for mutagenesis.
Mutants with each alanine and identical cost substitutions of the coupling helix residues had been expressed in HEK cells at wild-type hMRP1 ranges and their transport exercise was solely reasonably compromised. In distinction, mutants of the flanking amino acids (G392I, Y404A, R405A/Ok, E422A/D, and F434Y) had been very poorly expressed though Y404F, E422D, and F434A had been readily expressed and transport competent.
Modeling analyses indicated that Glu422 and Arg615 may type an ion pair that may stabilize transporter expression. Nevertheless, this was not supported by change mutations E422R/R615E which did not enhance hMRP1 ranges. Further constructions accompanied by rigorous biochemical validations are wanted to higher perceive the bonding interactions essential for steady hMRP1 expression.

Construction dictates the mechanism of ligand recognition within the histidine and maltose binding proteins

Two mechanisms, induced match (IF) and conformational choice (CS), have been proposed to elucidate ligand recognition coupled conformational adjustments. The histidine binding protein (HisJ) adopts the CS mechanism, through which a pre-equilibrium is established between the open and the closed states with the ligand binding to the closed state.
Regardless of being structurally just like HisJ, the maltose binding protein (MBP) adopts the IF mechanism, through which the ligand binds the open state and induces a transition to the closed state. To know the molecular determinants of this distinction, we carried out molecular dynamics (MD) simulations of coarse-grained twin construction based mostly fashions.
We discover that intra-protein contacts distinctive to the closed state are ample to advertise the conformational transition in HisJ, indicating a CS-like mechanism. In distinction, further ligand-mimicking contacts are required to “induce” the conformational transition in MBP suggesting an IF-like mechanism.
Crystal structure of a MarR family protein from the psychrophilic bacterium Paenisporosarcina sp. TG-14 in complex with a lipid-like molecule
In settlement with experiments, destabilizing modifications to 2 structural options, the backbone helix (SH) and the balancing interface (BI), current in MBP however absent in HisJ, scale back the necessity for ligand-mimicking contacts indicating that SH and BI act as structural restraints that maintain MBP within the open state.
We introduce an SH like ingredient into HisJ and observe that this will impede the conformational transition rising the significance of ligand-mimicking contacts. Equally, simultaneous mutations to BI and SH in MBP scale back the barrier to conformational transitions considerably and promote a CS-like mechanism.

Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His)

CU63-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

MARCO Recombinant Protein (Human)

RP018841 100 ug Ask for price

MARCO Recombinant Protein (Rat)

RP210899 100 ug Ask for price

Mouse Macrophage receptor MARCO, Marco ELISA KIT

ELI-16328m 96 Tests
EUR 865

Mouse Macrophage Receptor MARCO (MARCO) ELISA Kit

abx389793-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Macrophage Receptor MARCO (MARCO) Antibody

20-abx135966
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Macrophage Receptor MARCO (MARCO) Antibody

20-abx322023
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse MARCO shRNA Plasmid

20-abx971431
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Marco ELISA Kit| Mouse Macrophage receptor MARCO ELISA Kit

EF015428 96 Tests
EUR 689

MARCO Antibody

1-CSB-PA880072ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MARCO. Recognizes MARCO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MARCO antibody

70R-8509 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MARCO antibody

MARCO antibody

70R-6455 50 ug
EUR 467
Description: Rabbit polyclonal MARCO antibody raised against the N terminal of MARCO

MARCO siRNA

20-abx923573
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MARCO siRNA

20-abx923574
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Macrophage Receptor MARCO (MARCO) ELISA Kit

20-abx385113
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Macrophage receptor MARCO, MARCO ELISA KIT

ELI-39124h 96 Tests
EUR 824

Marco ORF Vector (Mouse) (pORF)

ORF049829 1.0 ug DNA
EUR 506

MARCO Protein Vector (Mouse) (pPB-C-His)

PV199314 500 ng
EUR 603

MARCO Protein Vector (Mouse) (pPB-N-His)

PV199315 500 ng
EUR 603

MARCO Protein Vector (Mouse) (pPM-C-HA)

PV199316 500 ng
EUR 603

MARCO Protein Vector (Mouse) (pPM-C-His)

PV199317 500 ng
EUR 603

MARCO Polyclonal Antibody

27273-100ul 100ul
EUR 252

MARCO Polyclonal Antibody

27273-50ul 50ul
EUR 187

MARCO Rabbit pAb

A10048-100ul 100 ul
EUR 308

MARCO Rabbit pAb

A10048-200ul 200 ul
EUR 459

MARCO Rabbit pAb

A10048-20ul 20 ul
EUR 183

MARCO Rabbit pAb

A10048-50ul 50 ul
EUR 223

MARCO Blocking Peptide

33R-3464 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCO antibody, catalog no. 70R-8509

MARCO Blocking Peptide

33R-7477 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCO antibody, catalog no. 70R-6455

MARCO cloning plasmid

CSB-CL880072HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1563
  • Sequence: atgagaaataagaaaattctcaaggaggacgagctcttgagtgagacccaacaagctgcttttcaccaaattgcaatggagcctttcgaaatcaatgttccaaagcccaagaggagaaatggggtgaacttctccctagctgtggtggtcatctacctgatcctgctcaccgctg
  • Show more
Description: A cloning plasmid for the MARCO gene.

MARCO Polyclonal Antibody

ABP59218-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of MARCO from Human, Mouse. This MARCO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460

MARCO Polyclonal Antibody

ABP59218-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of MARCO from Human, Mouse. This MARCO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460

MARCO Polyclonal Antibody

ABP59218-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of MARCO from Human, Mouse. This MARCO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460

MARCO Polyclonal Antibody

ES9781-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MARCO from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MARCO Polyclonal Antibody

ES9781-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MARCO from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MARCO antibody

STJ112088 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. The protein may bind both Gram-negative and Gram-positive bacteria via an extracellular, C-terminal, scavenger receptor cysteine-rich (SRCR) domain. In addition to short cytoplasmic and transmembrane domains, there is an extracellular spacer domain and a long, extracellular collagenous domain. The protein may form a trimeric molecule by the association of the collagenous domains of three identical polypeptide chains.

Anti-MARCO antibody

STJ190939 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MARCO

Mouse Anti Hamster Marco Monoclonal Antibody

DMABT-47716MH 0.25 mg
EUR 741

Marco sgRNA CRISPR Lentivector set (Mouse)

K3658301 3 x 1.0 ug
EUR 339

Mouse Macrophage Receptor With Collagenous Structure (MARCO) Protein

20-abx650074
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Recombinant Macrophage Receptor With Collagenous Structure (MARCO)

4-RPC614Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q60754
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Macrophage Receptor With Collagenous Structure expressed in: E.coli

Recombinant Macrophage Receptor With Collagenous Structure (MARCO)

4-RPC614Ra01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: M0R9F7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Macrophage Receptor With Collagenous Structure expressed in: E.coli

MARCO ELISA KIT|Human

EF005227 96 Tests
EUR 689

MARCO Polyclonal Conjugated Antibody

C27273 100ul
EUR 397

Human MARCO shRNA Plasmid

20-abx955715
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Marco sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3658302 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3658303 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3658304 1.0 ug DNA
EUR 154

MARCO Protein Vector (Human) (pPB-C-His)

PV025121 500 ng
EUR 329

MARCO Protein Vector (Human) (pPB-N-His)

PV025122 500 ng
EUR 329

MARCO Protein Vector (Human) (pPM-C-HA)

PV025123 500 ng
EUR 329

MARCO Protein Vector (Human) (pPM-C-His)

PV025124 500 ng
EUR 329

MARCO Protein Vector (Rat) (pPB-C-His)

PV281202 500 ng
EUR 603

MARCO Protein Vector (Rat) (pPB-N-His)

PV281203 500 ng
EUR 603

MARCO Protein Vector (Rat) (pPM-C-HA)

PV281204 500 ng
EUR 603

MARCO Protein Vector (Rat) (pPM-C-His)

PV281205 500 ng
EUR 603

Marco ORF Vector (Rat) (pORF)

ORF070301 1.0 ug DNA
EUR 506

MARCO ORF Vector (Human) (pORF)

ORF006281 1.0 ug DNA
EUR 95

Rat Macrophage Receptor With Collagenous Structure (MARCO) Protein

20-abx650075
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Marco sgRNA CRISPR Lentivector set (Rat)

K6667901 3 x 1.0 ug
EUR 339

MARCO sgRNA CRISPR Lentivector set (Human)

K1270701 3 x 1.0 ug
EUR 339

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse)

4-PAC614Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO)

Marco sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3658305 3 x 1.0 ug
EUR 376

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), APC

4-PAC614Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), Biotinylated

4-PAC614Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Biotin.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), Cy3

4-PAC614Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Cy3.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), FITC

4-PAC614Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with FITC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), HRP

4-PAC614Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with HRP.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), PE

4-PAC614Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with PE.

Macrophage Receptor With Collagenous Structure (MARCO) Antibody

20-abx131562
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Macrophage Receptor With Collagenous Structure (MARCO) Antibody

20-abx131563
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Marco sgRNA CRISPR Lentivector (Rat) (Target 1)

K6667902 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Rat) (Target 2)

K6667903 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Rat) (Target 3)

K6667904 1.0 ug DNA
EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 1)

K1270702 1.0 ug DNA
EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 2)

K1270703 1.0 ug DNA
EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 3)

K1270704 1.0 ug DNA
EUR 154

Marco 3'UTR Luciferase Stable Cell Line

TU112920 1.0 ml Ask for price

Marco 3'UTR GFP Stable Cell Line

TU162920 1.0 ml Ask for price

Marco 3'UTR Luciferase Stable Cell Line

TU212886 1.0 ml Ask for price

Marco 3'UTR GFP Stable Cell Line

TU262886 1.0 ml Ask for price

MARCO 3'UTR GFP Stable Cell Line

TU063026 1.0 ml
EUR 1394

MARCO 3'UTR Luciferase Stable Cell Line

TU013026 1.0 ml
EUR 1394

Marco sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3658306 1.0 ug DNA
EUR 167

Marco sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3658307 1.0 ug DNA
EUR 167

Marco sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3658308 1.0 ug DNA
EUR 167

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC614Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC-Cy7.

MARCO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV622369 1.0 ug DNA
EUR 682

MARCO Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV622373 1.0 ug DNA
EUR 682

MARCO Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV622374 1.0 ug DNA
EUR 682

Marco sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6667905 3 x 1.0 ug
EUR 376

MARCO sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1270705 3 x 1.0 ug
EUR 376

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat)

4-PAC614Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly367~Arg519)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO)

MARCO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV622370 1.0 ug DNA
EUR 682

MARCO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV622371 1.0 ug DNA
EUR 740

MARCO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV622372 1.0 ug DNA
EUR 740
Collectively, our outcomes present that structural restraints current within the protein construction can decide the mechanism of conformational transitions and even easy fashions that accurately seize such structural options can predict their positions. MD simulations of such fashions can thus be used, together with mutational experiments, to manage protein ligand interactions, and modulate ligand binding affinities.

Leave a Reply

Your email address will not be published. Required fields are marked *